Panama is quarantining women and men on different days during its coronavirus lockdown
Around the world, seismologists are observing a lot less ambient seismic noise -- meaning, the vibrations generated by cars, trains, buses and people going about their daily lives. And in the absence of that noise, Earth's upper crust is moving just a little less. [CNN]
What NASA is doing to keep COVID-19 off the space station
Several dogs and cats have tested positive to COVID-19 virus following close contact with infected humans. Studies are underway to better understand the susceptibility of different animal species to the COVID-19 virus and to assess infection dynamics in susceptible animal species. Currently, there is no evidence to suggest that animals infected by humans are playing a role in the spread of COVID-19. Human outbreaks are driven by person to person contact. [World Organisation for Animal Health]
A tiger at the Bronx Zoo tests positive for the coronavirus, and other big cats there appear ill.
In some regions of the country, non-coronavirus deaths were rising at an alarming rate alongside confirmed COVID-19 deaths — the total death count was up as much as sixfold from previous years. Those deaths officially attributed to the coronavirus accounted for barely a quarter of the increase. [...] How many “excess deaths” are patients who have COVID-19 but haven’t been diagnosed with it, and how many are patients with other illnesses who can’t get proper treatment in overwhelmed hospital systems? [...] In Bergamo, a city northeast of Milan, about 20 percent of all family physicians have been infected. [NY mag]
30 million Americans could lose their private health insurance over the next few months
American Indians have the highest rates of diseases that make covid-19 more lethal. Conditions in Indian Country are ripe for a rapid spread of the coronavirus. Rates of infection among Navajos is a major concern.
Gates said he was picking the top seven vaccine candidates and building manufacturing capacity for them. "Even though we'll end up picking at most two of them, we're going to fund factories for all seven, just so that we don't waste time in serially saying, 'OK, which vaccine works?' and then building the factory," he said. [Business Insider]
Every day, millions of people around the world type their health symptoms into Google. We can use these searches to help detect unknown Covid-19 outbreaks, particularly in parts of the world with poor testing infrastructure. [...] There is now strong evidence that anosmia, or loss of smell, is a symptom of Covid-19, with some estimates suggesting that 30-60 percent of people with the disease experience this symptom. In the United States, in the week ending this past Saturday, searches for “I can’t smell” were highest in New York, New Jersey, Louisiana, and Michigan — four of the states with the highest prevalence of Covid-19. [...] Searches for “no puedo oler” (“I can’t smell”) are some 10 times higher per Google search in Ecuador than they are in Spain, even though Ecuador officially reports more than ten times fewer Covid-19 cases per capita than Spain does. Ecuadorians are also right near the top in searches for fever, chills and diarrhea. [...] searches for “non sento odori” (“I can’t smell”) were elevated in Italy days before the symptom was reported in the news. [...] The three searches most related to Covid-19 disease rates were not a surprise: loss of smell, fever and chills. The fifth and sixth searches weren’t much of a surprise either: nasal congestion and diarrhea, which have also received a lot of attention as Covid-19 symptoms. However, the fourth-place search was a surprise: eye pain, which has not garnered much attention as a possible symptom of the disease. Seth Stephens-Davidowitz | NY Times
Do we really need to weigh lives against money? If so, how do you do it right? [...] As human beings, we tend to see life as having almost infinite value, but it’s also worth remembering that money spent to save one life has an opportunity cost: It could have been spent in another fashion and—if spent more efficiently—saved even more lives. Resources are never unlimited, and without assessing the dollars-to-lives tradeoff, it’s likely that policymakers will fail to save as many lives as they otherwise could. [...] Here’s where assigning a dollar value to life-extending benefits enters the equation. One common way to do this is by using the “value of a statistical life,” or VSL, which reflects what current citizens are willing to pay to reduce their own risk of death. (It’s usually estimated by looking at how much extra compensation workers in dangerous professions get paid.) Estimates of the VSL vary, but tend to average about $10 million for Americans. If we assume, for example, that the government’s response to Covid-19 prevents an enormous death toll of 2 million citizens, the value of all those prevented deaths could be as much as $20 trillion. [...] Cost-benefit analysis can offer us a way to think about decisions, and put some boundaries around the likely outcomes. But even in simpler circumstances, it cannot always provide bright-line recommendations. And it can’t answer our deepest and most profound questions. In some cases, the calculus has to be driven not by a set of numbers, but by our values. [...] Contrary to popular belief, deaths go down during economic downturns. [...] Suicides tend to be low in wartime [...] The economy took a hit during the 1918 influenza pandemic, but cities that intervened earlier and more aggressively fared better. [Politico]
It is hard to start a new business, and if all the businesses shut down then it will be hard to start all new ones when the lockdowns end. [...] The U.S. government has announced that small businesses can apply to banks for loans to cover their payrolls, and that if they actually use the money to pay workers—if they don’t lay people off—then the government’s Small Business Administration will forgive the loans. [...] It is all very smart and elegant but there is a problem, which is that banks are a little nervous about vetting companies for the government and might just decline to do it. (The government will also guarantee the loans, even the ones that aren’t forgiven, so the banks take no credit risk.) Banks are, precisely, in the business of vetting applications from local restaurants, examining their financial records and deciding how much money they need. The government, meanwhile, is best equipped to generate magical quantities of money. [...] It is all very smart and elegant but there is a problem, which is that banks are a little nervous about vetting companies for the government and might just decline to do it. [Matt Levine | Bloomberg]
Report showed 43,000 fewer health-care jobs in mid-March than in mid-February. Hospital employment was almost precisely flat between the two months, but dental offices reported 17,000 fewer workers and doctors’ offices had 12,000 fewer. Since about three times as many Americans work in doctors’ offices as in dentists’ offices, that’s an especially hard hit to dental employment, which makes sense: Most dental services are not emergencies, and dental work creates significant risk of exposure to coronavirus. [...] “There are jobs that people decided wouldn’t be affected by coronavirus because they could be done remotely, but those jobs are dependent on people paying for those services.” All that job loss across the economy means less spending power in households and at businesses. And that may mean less business even for enterprises that can adjust to the stay-at-home orders and keep doing business. [NY mag]
Rich countries try radical economic policies to counter covid-19. History suggests that the effects will be permanent. [Economist]
This virus does have the ability to transmit far easier than flu. It's probably now about three times as infectious as flu. One of the [pieces of] information that we have pretty much confirmed now is that a significant number of individuals that are infected actually remain asymptomatic. That may be as many as 25%. [...] Of those of us that get symptomatic, it appears that we're shedding significant virus in our oropharyngeal compartment, probably up to 48 hours before we show symptoms. This helps explain how rapidly this virus continues to spread across the country, because we have asymptomatic transmitters and we have individuals who are transmitting 48 hours before they become symptomatic. [...] This virus cannot go from person to person that easily. It needs us to be close. It needs us to be within 6 feet. If we just distance ourselves, this virus can't sustain itself and it will go out. [Dr. Robert Redfield, CDC Director | NPR]
Inside the Coronavirus Genome
Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome. The first sequence of RNA letters reads: auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag
Two episodes from The Daily, NY Times podcast: The Race for the Vaccine and Why the U.S. Is Running Out of Medical Supplies
It's theoretically possible that coronavirus could infect the region of the brain responsible for smell. [...] “The pure smell sense would be if you can smell a particular substance that’s not stimulating other nerves. [...] For example, Ammonia or cleaning solutions, those stimulate the trigeminal nerve, which is an irritant nerve. And so people will think, ‘Oh, I can smell Clorox, I can smell ammonia, which means I can smell.’ But no, that’s not correct. They’re not actually smelling, they’re using the trigeminal nerve.”
For the first time in history, most American adults carry an always-on geolocation device—their smartphone—on their person most of the time. Many popular smartphone apps passively transmit user location—via cellular, GPS, WiFi, or Bluetooth technology—to app companies at all hours of the day. [...] These are rich datasets that public health officials and researchers are using to evaluate shelter-at-home compliance and model COVID-19 transmission speeds. For example, officials in Austria and Italy are already using anonymized location information from mobile phone company records to examine the efficacy of their COVID-19 lockdowns. Similar analysis is underway in the United States. [...] If most residents are spending 22 hours in one location except for brief visits to the grocery store and parks, that is a reliable sign that people are engaging in fairly strict social distancing behaviors [...] Combining these data with reported infection and hospitalization rates will allow policymakers to analyze various jurisdictions and geographic areas based on a matrix of risk levels. [Mercatus]
No-Sew Pleated Face Mask with Handkerchief and Hair Tie
Cumulative counts of COVID-19 cases by U.S. state over time
How Taiwan has kept the virus under control
Some countries’ first impulses are to cover up the spread of the disease. We look at a few of those efforts, plus some brutal methods of enforcing stay-at-home orders. [Slate]
A pilot wrote a coronavirus message in the sky [March 19]
Unsolicited Advice for Living in the End Times
‘Zoombombing’ is a federal offense that could result in imprisonment, prosecutors warn + A Hacker Found a Way to Take Over Any Apple Webcam
trapped in an eternal honeymoon in the Maldives
Berlin’s drug dealers adapt to life under coronavirus lockdown [Finacial Times | unlocked]
This is for all the landlords out there. [Thanks Tim]
unrelated:
The caption of this photo probably triggered one of the biggest edit wars in Wikipedia’s history.